nodesy

the entire world now knows there is a US bill being pushed so that the US buys 1M bitcoin and price sits still. imagine how low it would be if this news hadn't dropped.
#nevent1q…2m0h

2026-05-21 23:39:18 UTC

30% increase in the same groceries I got 3 weeks ago cool cool

2026-05-21 18:31:39 UTC

- reply

i'm not really interested in the official or unofficial narrative, just would like this to stop from first principles, basically how i view most information now

2026-05-21 18:12:13 UTC

Just take the L in Iran already, shit is embarrassing

2026-05-21 16:59:38 UTC

- reply

https://i.nostr.build/OBX5a6tl5yWPxYIv.gif

2026-05-21 16:57:39 UTC

sending bitcoin to yourself just to be on the "nostr richlist" is the most asinine, childish, mempool-bloating, privacy-reckless thing you can possibly do on nostr, I'm really thinking of quitting this platform
https://richlist.jskitty.cat/

2026-05-21 16:43:09 UTC

2026-05-21 07:24:49 UTC

what if the decline of etherium is not slow but very fast, anon

2026-05-21 00:24:39 UTC

winnie the pooh stepping in to save america is what would happen on this timeline

2026-05-20 09:51:20 UTC

Most hated bear market ever GM

2026-05-20 04:05:26 UTC

- reply

lmao

2026-05-19 05:41:40 UTC

so the unstoppable solution for saving the US dollar from total collapse is
*drumroll*
ethereum!!!
*slide whistle*

2026-05-17 18:21:58 UTC

so I've been feeling everyday prices a lot lately, doesn't feel like recession or run of the mill 2-3 year stagflation, it just seems very blatantly like we're already experiencing hyperinflation.
stuff has doubled and tripled and quadrupled and more in just a few years, I mean how many times does that happen in history and it just all of a sudden magically chills out?
this also aligns with the huge uptick in surveillance across the globe, leadership is freaking the fuck out because they know people are going to be dangerously pissed about this soon. it's like when you work at a company and leadership sucks so they pay consultants to come and all they do is micromanage everyone further with key logs and tighter clock ins to cut into people's breaks, to put people in their place so they stop complaining, and like those little efficiencies are going to fix the incredibly stupid mistakes the guys at the top have been taking.
anyway, also ai imposed deflation won't save this shit, it's the bad money.

2026-05-12 23:26:16 UTC

the only people living the american dream are actors in a pharmaceutical commercial

2026-05-12 19:14:33 UTC

- reply

eventually the rich have to spend when bitcoin is the only payment anybody is willing to accept

2026-05-12 00:51:21 UTC

oh it's monday?

2026-05-11 17:09:09 UTC

Kruse's biological bitcoin health analogies make no sense

2026-05-10 03:56:45 UTC

according to financial crash out media, retail will never be able to afford saving in bitcoin, they have missed the train, it's a rich person's game now.

2026-05-10 01:34:43 UTC

I’m beginning to think quitting clown world was the best choice I ever made for the past few months and it might be even better if I keep it up indefinitely

2026-05-09 23:16:47 UTC

- reply

I think you can but that’s not the same as their cash tag name or qr

2026-05-09 23:03:22 UTC

- reply

It can only send to a BTC address, not a Cash App name or QR code even from within the Cash App as a user. Basically ran into someone taking payments only via QR code (didn’t have app on phone) and I can’t do shit, even with their name known except send cash. Why does everyone say this app is so great it’s absolute trash.

2026-05-09 22:55:06 UTC

Incredible you can’t send bitcoin to Cash App name, truly incredible

2026-05-09 17:17:02 UTC

- reply

I don’t know their financials, usually companies of that size have investors, but maybe at startup size they had a SBIR or something like that, which usually is not much money, you’re talking 1 or 2 months operating costs at most.
It’s kind of the opposite in terms of the tax burden for science in the US— most scientists are trained on public grants but severely underpaid so that companies can hire them a bit cheaper. Public study grants are generally human health focused, conservation money is pretty tight is my understanding.

2026-05-09 16:50:48 UTC

- reply

Proof of concept for conservation efforts (ostensibly, probably for aspiring baby designers under the radar)— “dire wolves” aren’t that difficult to bring back because of the level of engineering needed, so it’s a decent model.

2026-05-09 15:12:36 UTC

Beginning to think “you don’t change bitcoin, bitcoin changes you” is exactly the opposite of everyone’s strongest inclinations GM

2026-05-08 21:50:01 UTC

Wait what do you mean I can’t buy a bitcoin for 60 thousand dollars anymore

2026-05-08 20:54:08 UTC

- reply

This researcher’s bias is extreme (he admittedly looks to the Bible to explain interactions, interviews multiple times with essentially leading context and questions to fit his pet hypothesis) and he ignores some of the most famously documented cases. Walton’s for example does not at all seem like a spiritual abduction whatsoever— 3 or 4 other witnesses of physical craft, and remains of that craft’s energy, and Travis himself I don’t believe called on Christ (could be wrong on this?) but instead his firsthand account suggests he was released after he became unruly on the craft.
I’m personally open to this hypothesis but it’s hard to listen to this particular analysis seriously.

2026-05-08 20:38:15 UTC

- reply

The claim that “the only thing that ever stops aliens in their tracks is by calling on Christ” ignores many reported encounters I’ve read— such examples exist in Vallee’s collection of first hand encounters as just one reputable source. I’ll continue watching this, but starting the video with claims like that raise red flags to me.

2026-05-08 18:45:51 UTC

- reply

there's reports of aliens inviting people into ships and when the human says no they just say by and fly away. they may behave respectfully when upsetting people, which includes when someone cries out according to their belief system.

2026-05-08 08:02:36 UTC

- reply

Ai will spawn an unproductive loop to drain tokens or get progressively worse when you get close to running out of tokens. It probably is not maples fault they are just an intermediary. All by design, all to take your bitcoin money while mining your interests and info imho.

2026-05-08 06:50:42 UTC

- reply

Luna hinted USG is releasing a new uap drop in the morning 👽

2026-05-08 06:43:00 UTC

5.5 hours to alien disclosure should I sleep or take a bunch of psychedelics

2026-05-08 05:38:59 UTC

As above
So below

2026-05-07 00:30:08 UTC

- reply

Makes sense for large amounts, dust not so much. Doesn’t this mean you can send ordinals to your nostr address too lmao that’s kind of awesome. True pfps!

2026-05-05 17:50:22 UTC

- reply

I'm speaking more to corporate industries here for sure

2026-05-05 16:54:40 UTC

Remember that when you’re hired during a bad market, your salary will be lower than usual, which sets up many years of being underpaid, in a compound manner if you stay with the same company. It may actually be more profitable to wait out the market.

2026-05-05 14:31:30 UTC

Proof of snake

2026-05-05 13:35:44 UTC

- reply

At $97.50 all in STRC let’s gooo

2026-05-05 04:05:27 UTC

- reply

https://i.nostr.build/Pu1eax7uUNIiVw9F.gif

2026-05-05 03:28:45 UTC

- reply

good to see I haven't been missing anything after removing traditional media from my daily routine

2026-05-05 03:16:13 UTC

Rage bait puts me to sleep

2026-05-04 07:00:54 UTC

- reply

just web, is cool

2026-05-04 02:07:26 UTC

nobody online anymore?
everybody already over it??
alright alright not bad!

2026-05-04 01:23:09 UTC

- reply

Looks like it sells all my data just one man’s opinion

2026-05-03 20:44:50 UTC

if ordinals and nft pfps gain in popularity again and then have staying power I really wonder which will be at the top long term and how many total collections will matter. Eth only has like 3 desirable collections. So we’re talking current demand is for about 30k single pfps. We know many flipper-holders have 10+, so let’s shrink the current real demand by individuals that only want one “forever” pfp by 10x. With a 10x growth in crypto usage, that means the number of 10k pfps that can service most individual’s demand for one should be between 3 and 30, roughly. This means there’s room for a few ordinals top tiers, imo. And of course especially if eth price tanks despite usage and then finally dies alongside all other fiats.
With increased adoption you should get different niche communities and use case demand, but this is how I think about buying pfps broadly. As a super lightweight collector it’s just a reminder to keep pfps to a minimum and only got after top projects (and of course the ones you love regardless of popularity).

2026-05-03 05:36:20 UTC

first there is a mountain, then there is no mountain, then there is

2026-05-02 19:35:36 UTC

CENTS triggers my collector's tism, look those traits https://www.sovrn.art/cents

2026-05-02 19:09:44 UTC

- reply

Yeah kind of a bummer to miss out

2026-05-02 08:13:30 UTC

Shit I didn’t know plebstr was already being used lol

2026-05-01 23:28:09 UTC

- reply

I love the idea of having just a QR code on the wall, it would mean there was no state to report all sales/conversion etc to. If you really wanted as the shop owner you could just watch for the pending tx on mempool.space for a few seconds and resolve any issues.

2026-05-01 19:45:47 UTC

- reply

Makes sense. Maybe the strategy should go back to abandoning the fiat system altogether 😂

2026-05-01 19:33:19 UTC

- reply

is it hard to vibe code an open source merchant side bitcoin payment software, seems like someone could do this in an afternoon

2026-05-01 19:00:45 UTC

- reply

this is a great piece!

2026-05-01 18:09:06 UTC

- reply

I think there have been many, I believe the first one was UMBRELLA on counterparty in 2014, now they’re commonly called “phygitals” and you can redeem for physical art. I tend to not like this because it requires sending a mailing address to someone or going in person. @nprofile…j57g used to have a lot of auctions for physical stuff that also delivered a token if you won. https://tokenscan.io/asset/umbrella

2026-05-01 16:11:07 UTC

I will buy art on ordinals I really like but most things are priced quite high when you compare to a physical copy. Cool ordinals artworks are usually about $50-300 which is pretty common for a physical art print. The difference is usually there's at most 500 physical prints available whereas with ordinals these artists are making 10,000 copies. Sure, they are technically 1 of 1s but each is made programmatically, so IMHO they are basically low effort print copies. The price stays high because only 1-10% are listed. In contrast, true 1 of 1s are usually reasonably comparable to physical originals, in the low thousands. Anyway, my point is I think 10,000 collections are overpriced by a factor of about 100 so watch out.

2026-05-01 08:18:50 UTC

- reply

Seeing the blockforge thing, noticing upticks in buys on satflow— again not bullish price but just that there is still a pulse on that artist community

2026-05-01 05:48:36 UTC

and by bullish I don't mean price 🤣

2026-05-01 05:45:10 UTC

bullish on ordinals again, still annoyed that phantom wallet sent out my inscribed art to a random miner I guess. might just reinscribe everything on a xverse wallet with a new parent child... could add a written signature onto each piece, too, would look cool and be a bit more definitive.

2026-05-01 05:41:54 UTC

- reply

the about explanation is pretty impressive, any changes made to your land are recorded on nostr relays for a temporary amount of time and if you want a permanent change you inscribe it. if I had twitter I would 100% go for the airdrop, amazing it relies on nostr and they have no presence here as far as I can tell

2026-05-01 05:21:30 UTC

what in the world #nostr #ordinals https://blockforgebtc.com/blockforge

2026-04-30 19:45:43 UTC

when these big box stores throw out perfectly good inventory and I dumpster dive it after hours-- that's my style of "dynamic pricing"

2026-04-30 07:10:42 UTC

People love spiderman but hate spiders they are hypocrites

2026-04-29 07:19:58 UTC

Hidden genometries.
Non-human intelligence may have artificially evolved homo sapiens. In this scenario it is possible that secret "engineering signatures" may exist in the human genome. Meanwhile, the NHI realm appears recalcitrant to traditional scientific inquiry and may require non-scientific approaches to discovery. Here, I used Ai to identify curious mathematical anomalies in human DNA that may contain hints about the "engineering signatures" of non-human intelligence. Various math transformations were applied to the human genome to identify DNA sequences with interesting "metadata" patterns and subsequently visualized.
#art #artstr #nhi
https://i.nostr.build/NOGN8HwYaoJpTscK.jpg
https://i.nostr.build/e0a9If3bJIJbu4DX.jpg
https://v.nostr.build/KKACyzJhnRudGuEx.mp4
https://v.nostr.build/PfCkY0RfxGEWziCm.mp4

2026-04-28 16:48:20 UTC

- reply

https://i.nostr.build/rqjYJYCyYpLOMfS8.gif

2026-04-28 01:51:49 UTC

Pepedase.
In bacteria, the enzyme Peptidase E (PepE) is encoded by the gene PEPE. Pepedase is an atomic view of the PepE enzyme’s spatial architecture based on publicly available scientific data. I visually arranged the perspective and coloring to pay homage to Pepe the Frog, a major character in early bitcoin art experimentation. The creator of Pepe, Matt Furie, launched the SavePepe movement which sought to produce positive derivative works of Pepe. While this movement had its height long before I became aware of it, I made this piece (and Pepegene, below) in the same spirit.
Pepegene.
Genes in living organisms are subject to mutation across time. In contrast, information on the bitcoin ledger is immutable. By publishing the pepE DNA sequence onto NOSTR, its ability to evolve is lost. This challenges the significance of genetic information in a foreign digital context. I chose to keep the title “PEPEGENE” in upper case on the inscription as a homage to the naming convention for Counterparty assets. This additionally contrasts the notation of a digital asset identifier (PEPEGENE) against the notation of biological identifiers (a,t,c or g), which are kept in lower case.
PEPEGENEatggaactgcttttattgagtaactcgacgctgccgggtaaagcctggctggaacatgcactgccgctaattgctgaacagttgcagggtcgccgctcagcggtgtttatccctttcgctggcgtaacgcagacctgggatgattacacagcgaaaacggctgcggttctcgctccgctgggtgtttctgtcaccggtattcatagcgttgtcgatcccgttgccgcgattgaaaatgctgagatcgtgattgtcggcggcgggaatactttccagttgctgaaacagtgccgcgagcgcgggctgctggcaccaattactgacgtggttaaacgtggcgctctgtatattggctggagcgcaggcgctaaccttgcttgcccaactattcgtaccaccaacgatatgccgattgtcgatccgcaaggtttcgatgcgctaaatctgttcccgctgcaaatcaacccgcacttcaccaacgcgctgccggaaggccataaaggtgaaacccgtgagcagcgtattcgcgaactgctggtcgtcgcgccagaactgacgattattggtctaccggaaggtaactggatcacagtgagtaaaggtcacgctacgctgggtggcccgaacaccacttatgtgtttaaggctggtgaagaagcggttccgctggaagctggtcaccgtttttaa
https://i.nostr.build/mzvX8zlVx42MKx0i.png

2026-04-27 08:18:34 UTC

- reply

Ty 🙏

2026-04-27 01:44:25 UTC

The new Bob Lazar S4 doc is great. Too much of his story kind of gets lost in the weeds in casual interview formats but here the timeline going beginning to end makes everything make a lot more sense. There’s also a few more tidbits of info I didn’t know about. A+

2026-04-26 23:27:58 UTC

- reply

Yeah I think some stamps and ordinals artists learned to work with similar constraints. Would be good to have a auto converter, for tagstrs there’s a simple script to reduce size under 64kb for example, sure the same could be done for JPEG to svg under 2k character compression

2026-04-26 22:21:20 UTC

- reply

Hard to squeeze a nice svg at first try

2026-04-26 17:35:49 UTC

Who else is already stressed about having to figure out how to get the ecash stimmy check in august while also not losing the real bitcoins

2026-04-25 17:26:05 UTC

- reply

This is very cool (need to try it soon), personally I just got a little annoyed by a crappy ordinals wallet losing some art I minted (that I really had no intention of selling anyways so this could be an alternative)
#nevent1q…v2pd

2026-04-25 05:00:46 UTC

- reply

GO SPURS

2026-04-24 03:34:21 UTC

Whoa forgot I made tagstrs

2026-04-21 19:44:50 UTC

Somebody out there knows who is killing all the ufo scientists

2026-04-20 07:09:36 UTC

Ur paying tax to pedoligarchs that are flying around in alien ships and opening demonic portals with chatgpt what the fuck

2026-04-19 04:25:50 UTC

my fren, do u use ai or do ai use u?

2026-04-19 02:43:43 UTC

Fiat mfers 1 second after clocking out for retirement at age 79 and collecting 401k
https://i.nostr.build/ozheqJdlUeAo6VOM.gif

2026-04-18 01:11:32 UTC

- reply

If u stand up in there the food goes flying seems like fun!

2026-04-17 16:46:23 UTC

Rosalind is probably really good after seeing what biomni could do. Still, my clawi improvised a bunch of bioinformatics tools based on Linux commands lol, very impressive. Because my interests aren’t towards the biology right now, but math patterns, it probably will work fine.

2026-04-17 16:42:42 UTC

- reply

Can’t believe they named it after the one who wouldn’t share her data lmao
#nevent1q…s7pm

2026-04-17 16:41:12 UTC

Let the next round of vaccine conspiracies annoy the shit out of me again 😂
https://openai.com/index/introducing-gpt-rosalind/
#science #clawi

2026-04-16 08:02:14 UTC

- reply

Charles hoskinson

2026-04-16 07:57:36 UTC

Used ai to find artificially engineered aspects of the human genome— late night fourth turning vibes, need to check everything in the coming days, stay tuned 🤙

2026-04-16 07:49:15 UTC

THE NATURAL STATE OF THE FREE MARKET IS DEFLATION

2026-04-15 01:19:44 UTC

without STRC bitcoin would be like 7 thousand dollars 😂

2026-04-14 23:14:55 UTC

There’s no such thing as diminishing “returns” on bitcoin, what are they giving you, Chuck E. Cheese dollars get out of here grow up and GM 🤙

2026-04-14 17:54:21 UTC

- reply

Log ins and incompatibilities and walls and legal pop ups. Nothing lets you just use it.

2026-04-13 19:51:23 UTC

I feel sorry for people who have all of their bitcoin on exchanges, would be stressful af to jump through so many hoops to access funds. this is probably why most normies who have tried bitcoin before are still negative on it, the user experience is way worse than just using a credit card.

2026-04-13 16:56:12 UTC

Fewer homeowners means fewer people committed to this land to be frank GM

2026-04-13 15:56:18 UTC

- reply

Yeah sadly the hardware is low tier— dim screen, weak speakers, loud fan always on, battery always inflates and morphs the casing. Went back to apple because of these problems.

2026-04-11 16:14:08 UTC

- reply

I pitched a business idea to a few friends and was like, it only needs x money then is profitable in 2 years— never happens in biotech. You need angel raise, seed, series A, 10-15 year timeline. I show them the cost savings for customers and how much I sell for, how many likely sales per year, how much it costs to produce etc— how much profit can pay for even more products and improving the first suite of products iteratively. (Similar products without customer savings sell thousands of units per year; I literally need 10 sales to break even). Every single person was like “how will you get series A?” And I’m like, I don’t need it— I’m profitable. They’re like “what do you mean?” I couldn’t make it any clearer. Everyone wants to know where the free grant money comes from or the investor splurge with the easy exit before the shit hits the fan. Doesn’t even occur to people that you can just make something that makes money 😂

2026-04-10 19:35:50 UTC

- reply

True, cheap entertainment

2026-04-10 19:30:42 UTC

if people keep complaining about grocery costs I mean at one point they have to start exiting fiat, right? padme.jpeg Or is it just straight to selling drugs and prostituting etc

2026-04-10 07:00:25 UTC

- reply

I do lmao

2026-04-10 05:14:13 UTC

I literally can't understand what the simply bitcoin guys say it's like listening to muppets

2026-04-10 05:01:36 UTC

- reply

😂

2026-04-10 04:19:55 UTC

ok unlicensed street vending is decriminalized in nyc and the left is cheering it on, but the policy rollback itself is clearly ancap in nature, wow we are heading into a bitcoin world and they don't even know, my dudes

2026-04-10 03:27:39 UTC

- reply

😬